Functional Pathogenomics of Mucosal Immunity    R.E.W Hancock Laboratory    The Brinkman Laboratory

Pseudomonas aeruginosa PAO1mini-Tn5 lux transposon mutant library

Supplementary Information

Figure 1. Inverse PCR (IPCR)

Supplementary Table 1. Primer sequences used for inverse PCR reactions and sequencing

Supplementary Table 2. Inverse PCR Reactions and Cycling Conditions

 

Figure 1. Inverse PCR method to map mini-Tn5-lux transposon insertion sites. Genomic DNA was isolated (1) and digested with NarI or SstII (2). Linear genomic fragments were circularized by ligation with T4 DNA Ligase (3). Ligation product was used as template for an inverse PCR (IPCR) reaction using outward facing transposon-specific primers (4). IPCR products were purified for sequencing with a nested transposon-specific primer.

Back to top


Supplementary Table 1. Primer sequences used for inverse PCR reactions and sequencing

NarI–digested gDNA Primer sequence 5’ – 3’
IPCR primer 1 (Tn5-NarI) CATTCAGGTCGAGGTGGCCCG
IPCR primer 2 (Tn5-out2) CAGAACATATCCATCGCGTCCGCC
Sequencing primer (Tn5-out3) CGGTTTACAAGCATAAAGCTTGC
   
SstII-digested gDNA  
IPCR primer 1 (Tn5-SstII) GTCAAAAGGACGATTTCGGTTTGG
IPCR primer 2 (Tn5-out)
GATCCCCGGGTACCGAGCTCGAATTC
Sequencing primer (Tn5-out-seq) CCGGGTACCGAGCTCGAATTCG
   
SphI–digested gDNA  
IPCR primer 1 (Tn5-SphI) GACATGCGGATGTTATTGTCGCTTGGG
IPCR primer 2 (Tn5-out) GATCCCCGGGTACCGAGCTCGAATTC
Sequencing primer (Tn5-out-seq) CCGGGTACCGAGCTCGAATTCG

Back to top

Supplementary Table 2. Inverse PCR Reactions and Cycling Conditions

Reagent

Volume (ml)

Step

PCR Cycling Conditions

Template (Ligation reaction)

2.5

1

95C for 3 min

10 mM dNTPs (2.5 mM each)

2

2

95C for 30 sec

10 mM Primer 1

0.5

3

65C for 1 min (as low as 58C)

10 mM Primer 2

0.53

4

72C for 3 min

10 X Invitrogen Buffer

2.5

5

Go to Step 2, 4X

50 mM Invitrogen MgCl2

1

6

95C for 30 sec

H20

15.9

7

60C for 1 min (as low as 58C)

Invitrogen Taq (5 U/ul)

0.125

8

72C for 3 min

Final Volume

25

9

Go to Step 6, 29X

 

 

10

4C forever